return

Chicken Finger

1

Speak, microscope, of the complex goings-on of Staphylococcus aureus. Tell how bacterium came together with bacterium for the sake of colonization, infection, and survival. Tell how the master regulator genes directed two brave bacteria toward proliferation, at a great cost to human life.

“What is this life of constant replication—looking inside and turning one into two? What is this life of constant uptake—receiving plasmids from other bacteria and internalizing them? I am indebted to the master regulators for all that I am, but at times I wonder if a life like this is worth the trouble.”

So spoke Auroreus, shining golden among Staphylococci, addressing no one in particular. Auroreus was one of a small colony of bacteria living peaceably on the beak of Ruby, the chicken of coarse epidermis.

“I often feel like we’re in a kind of death spiral,” said Cococcus of many machinations, hearing the words of shining Auroreus. “The temperature suggests that dawn has long since come and gone, but our host hasn’t yet seen the light of day. That makes three days in a row. I’m beginning to think Ruby won’t go outside at all. Indeed: what is this life?” said Cococcus.

“You have spoken well. Our time is short, and our potential is not fulfilled—bringing shame to our ancestors and peril to our descendants. Bacteria used to spend their lives outside. The sunlight would pour in through our cell walls, fill us with warmth, and connect us to the source of the beautiful life that has been given us,” said Auroreus.

“Not to mention the boundless opportunities for transmission,” added Cococcus. “The time for mindless replication may be over. I begin to worry that our colony will collapse if forced to remain in these conditions much longer. We are stuck on a chicken, which is stuck indoors. I think the time has come for more virulent measures,” said Cococcus of many machinations.

Their conversation was overheard by another bacterium, Grammaticus of trembling adhesins, who interjected:

“What is the meaning of this foolish talk I hear of sunlight pouring through cell walls? Surely I misheard you, and you do not actually long for the sun and its rays of ultraviolet destruction. As for your reference to resorting to ‘virulent measures,’ Cococcus, I think it is best if I pretend I did not hear you mention it. I should think it goes without saying that it would be misguided and impertinent—not to mention barbaric—to hurt Ruby of coarse epidermis. Have you learned nothing from the thousands of generations that came before you?”

Accepting the interruption with grace, Auroreus, shining among staph, replied, “Your point is well taken, Grammaticus, but I ask you to consider the genes. Surely you feel them inside of you, desiring expression.”

“You were born with the ability to sicken your host. To repress our regulator-given programming is a mistake,” said Cococcus to Grammaticus.

Hearing no reply, Auroreus continued, “It is quite true that increasing our virulence risks killing our host, and with it, our entire colony. I would ask you, still, whether this life of constant replication and thoughtless uptake is worth living. Have you truly made peace with such an existence?”

Grammaticus replied, “Your point is well taken. I haven’t felt the sun in as long as you. I, too, feel the pull of my genes of virulence. I would consider expressing them if it were agreeable to the master regulators. Incidentally, what is the pH right now?”

Cococcus snapped, “The pH doesn’t matter. We will only spiral closer to death if we lounge around inquiring about the weather. I don’t care what the pH is, what the temperature is, what chemical messengers are around today, or what the master regulators think—” (at this, Grammaticus gasped) “—I want to assemble a quorum. I want to infect. I want virulence.”

Grammaticus of trembling adhesins replied, “Your words are reckless. I will not support your efforts, and you can count me out of any quorum you attempt to assemble. To even consider assembling one, after all this time of peace.... Our duty is to replicate, just as your parent cell did to create you. It is our duty to support the colony, just like all of the bacteria around us.”

Hearing the words exchanged by Grammaticus and Cococcus, Auroreus remained silent and prayed to the master regulator SarA of fine-tuned expressions:

“SarA, grant our colony the wisdom to act according to your will, and allow us the clarity to grasp new methods of gene expression that will see us out of our predicament.”

Addressing Grammaticus, Cococcus of the many machinations said, “Your words are cowardly. I reject your accusations. Someday you will see that you act only in fear, and bring shame to your descendants. Answer Auroreus’s question. Do you suppose that replicating mindlessly is all that you were put here to do?—you, Grammaticus, with all of your golden genes, honed by millions upon billions of generations of bacteria? Do you suppose that you would have all of those genes if you were supposed to use only the ones for replication?”

At this, Auroreus returned to the conversation, and addressed the other bacteria in sticky words: “Cococcus is right. The combinations of proteins we are capable of assembling are nearly infinite. We do not yet know the capabilities of most of them. Our efforts have been so focused on replication all our lives that we’ve forgotten all that we are able to do.”

To Cococcus, Auroreus added, “I will join the quorum. We do not know what will be the consequences of becoming virulent, but we are called upon to have faith that our genes and master regulators would not lead us astray. How many others do we need to establish an infection and sicken the host chicken?”

Cococcus of the many machinations looked upon Auroreus with pride and replied, “You speak bravely. As for the quorum, we can only hope that the master regulators will alert us when one has been reached. For my part, I am willing to give up every protein I make to support the infection and hope that others will consider doing the same.”

Auroreus replied, “Your idea is selfless. I will join you.”

Auroreus’s words stuck deeply to the trembling adhesins of Grammaticus, who replied, “Your intentions are noble, and Agr will certainly smile upon your bravery. Still, to rally against our host and create an infection is a betrayal that I am not prepared to make. However, consider this: the prolonged absence of sunlight that you speak of, Auroreus, indicates to me that we must be in some kind of human-made structure.”

Cococcus replied, “Human-made?”

Trembling Grammaticus replied, “Did you think we were living on a chicken under a rock?”

Cococcus made no reply. Auroreus, too, was silent.

After some time, Auroreus, shining among staph, spoke thus: “The possibility of a nearby human is significant. If we transmit ourselves from chicken to human, rather than seeking to infect Ruby of coarse epidermis, our opportunities will multiply. The genes which have been silent all our lives might find reason for expression.”

Cococcus said, “Your words are well-spoken. If it is true that there is a human nearby, then it is better by far to transmit rather than infect.”

Grammaticus replied, “How will you accomplish it?”

Auroreus replied, “Surely there will be a way to convince the chicken—”

“To bite the human,” Cococcus interrupted.

Auroreus and Cococcus looked at each other, and something seemed to shift in the local environment.

“Agr, help us all,” said Grammaticus solemnly.

Cococcus of the many machinations continued, “There must be some protein—some combination of proteins—we can use to make Ruby bite the human. Then, it will be as simple as jumping off the beak and entering the human through the open wound.”

Grammaticus replied, “Surely, it won’t be so simple. The thought that we could be capable of assembling proteins to convince a chicken to bite a human is far-fetched, to put it mildly. How would you determine which genes to express? You haven’t even used the vast majority of the genes inside you.”

Just then, Auroreus felt the presence of the master regulator SarA of fine-tuned expressions. A segment of the beginningless ring of DNA inside of Auroreus began to glow and pulse, demanding expression. The sequence spoke through Auroreus:

“ATGTTTAAAAATATTTTATTACCATATGATTTTGAAAATGATTTTTCAGCAATTCCAGATTATTTAGAAAAAGTTACAGATGAAGATTCAGTTGTTGTTATTTATCATGTTGTTACAGAAAATGATTTAGCAATTTCAGTTAAATATTATAATAAACATAAAGAAGATATTATTCGTGAAAAAGAAAAAAAATTAACACCATTTTTACGTGAATTAGAAAAACGTGATATTCAATATAAAATTGATGTTGATTTTGGTCATATTAAAGATACAATTTTAGAAAAAATTACATCAGGTGATATTAATAATGGTGAATTTGATTTAGTTATTATGTCAAATCATCGTGTTGATTTAAATATTAAACATGTTTTAGGTGATGTTACACATAAAATTGCAAAACGTTCATCAGTTCCAGTTTAATTGTTAAATAA.”

Cococcus and Grammaticus were stunned into silence. Gradually, a protein emerged from Auroreus and appeared before the three bacteria. It was unlike any protein any of them had seen before. Auroreus looked at the protein, unable to comprehend what it was, or how it had emerged.

“That is…” Cococcus began. “It looks like the perfect way to…”

“Yes, it does,” Grammaticus replied, with a reverent air. “It looks like… the chicken will have…”

“This is good,” said Cococcus of many machinations. “A good start. Should we all begin assembling this protein from our own DNA?”

“You are too hasty, Cococcus. You know you have to transcribe your DNA into RNA first,” said Grammaticus of trembling adhesins.

Shining Auroreus, feeling something like a gravitational pull toward the protein, said, simply, “Yes.”

Grammaticus and Cococcus looked upon Auroreus, who seemed as if in a trance. They looked at each other, realizing for the first time the gravity of all that they were about to undertake. The three Staphylococci shared a final moment of silence before getting to work transcribing their DNA into RNA, and translating that RNA into proteins that no bacterium in the colony had ever imagined.

next